About   Help   FAQ
Copg2-pA, Copg2-pB Primer Detail
Primers
  • Name
    Copg2-pA, Copg2-pB
  • Primer 1 Sequence
    TCACAAGCAGTCTGACCAAG
  • Primer 2 Sequence
    TTGGGCTTCATTTATCCATC
  • ID
    MGI:3710850
Genes
Copg2 coatomer protein complex, subunit gamma 2
Expression
  • Assay Results
    3
References
J:119954 Cui XS, et al., Transcription profile in mouse four-cell, morula, and blastocyst: Genes implicated in compaction and blastocoel formation. Mol Reprod Dev. 2007 Feb;74(2):133-43

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
11/30/2021
MGI 6.17
The Jackson Laboratory