About   Help   FAQ
D9Dcr36-pA, D9Dcr36-pB Primer Detail
Primers
  • Name
    D9Dcr36-pA, D9Dcr36-pB
  • Primer 1 Sequence
    GAGAGAATTTCCTGAGTAGGCACAA
  • Primer 2 Sequence
    CTTTCACAGATTCCAGTAGGTAGGTCT
  • ID
    MGI:3706874
  • Product Size
    106bp
  • Other IDs
    498953 (NCBI UniSTS)
Genes
D9Dcr36 DNA segment, Chr 9, Derry C. Roopenian 36
References
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;
J:119629 Sproule TJ, et al., Mapping of mouse Chromosome 9 primers. MGI Direct Data Submission. 2007;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
02/16/2021
MGI 6.16
The Jackson Laboratory