About   Help   FAQ
D9Dcr16-pA, D9Dcr16-pB Primer Detail
Primers
  • Name
    D9Dcr16-pA, D9Dcr16-pB
  • Primer 1 Sequence
    AGTGCATACACCTGTGCTCATGT
  • Primer 2 Sequence
    ACCACTCTAGCTGTGTTCTCTCTACTGT
  • ID
    MGI:3706849
  • Product Size
    96bp
  • Other IDs
    498932 (NCBI UniSTS)
Genes
D9Dcr16 DNA segment, Chr 9, Derry C. Roopenian 16
References
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;
J:119629 Sproule TJ, et al., Mapping of mouse Chromosome 9 primers. MGI Direct Data Submission. 2007;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
01/07/2020
MGI 6.14
The Jackson Laboratory