About   Help   FAQ
Pisrt1M, Pisrt1N Primer Detail
Primers
  • Name
    Pisrt1M, Pisrt1N
  • Primer 1 Sequence
    CAGTCTGACAAAGGAAGGTGA
  • Primer 2 Sequence
    ATTGCAGACTAAAGCGGGAGA
  • ID
    MGI:3698016
Genes
Pisrt1 polled intersex syndrome regulated transcript 1
Expression
  • Assay Results
    5
References
J:101893 Loffler KA, et al., Pisrt1, a gene implicated in XX sex reversal, is expressed in gonads of both sexes during mouse development. Mol Genet Metab. 2005 Sep-Oct;86(1-2):286-92

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
03/24/2020
MGI 6.15
The Jackson Laboratory