About   Help   FAQ
N5-3, N5-4 Primer Detail
Primers
  • Name
    N5-3, N5-4
  • Primer 1 Sequence
    CTCACTTCTTCCAGCCAACC
  • Primer 2 Sequence
    AGGGAGCCAGAATCTTCCAT
  • ID
    MGI:3664030
Genes
Thoc1 THO complex 1
Expression
  • Assay Results
    6
References
J:109614 Wang X, et al., Thoc1/Hpr1/p84 is essential for early embryonic development in the mouse. Mol Cell Biol. 2006 Jun;26(11):4362-7

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
11/16/2021
MGI 6.17
The Jackson Laboratory