About   Help   FAQ
Notch4-pC, Notch4-pD Primer Detail
Primers
  • Name
    Notch4-pC, Notch4-pD
  • Primer 1 Sequence
    CCAAGAGATTCCCTTAAACTCGG
  • Primer 2 Sequence
    CCAGAGTTTAGGGATTCTCG
  • ID
    MGI:3663398
Genes
Notch4 notch 4
Expression
  • Assay Results
    2
References
J:99326 Kuhnert F, et al., Dosage-dependent requirement for mouse Vezf1 in vascular system development. Dev Biol. 2005 Jul 1;283(1):140-156

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
11/26/2019
MGI 6.14
The Jackson Laboratory