About   Help   FAQ
Sox1-pG, Sox1-pH Primer Detail
Primers
  • Name
    Sox1-pG, Sox1-pH
  • Primer 1 Sequence
    AGGAGAACCCCAAGATGCAC
  • Primer 2 Sequence
    GCCAGCGAGTACTTGTCCTT
  • ID
    MGI:3654173
Genes
Sox1 SRY (sex determining region Y)-box 1
Expression
  • Assay Results
    3
References
J:109514 Vats KR, et al., A locus for renal malformations including vesico-ureteric reflux on chromosome 13q33-34. J Am Soc Nephrol. 2006 Apr;17(4):1158-67

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
03/24/2020
MGI 6.15
The Jackson Laboratory