About   Help   FAQ
ALF primers1 Primer Detail
Primers
  • Name
    ALF primers1
  • Primer 1 Sequence
    ATTATGCTAGCGCCTTCATCAACCTGGTGCCCA
  • Primer 2 Sequence
    TAGACGAGCTCTTACCACTCAGCTTCACCAATG
  • ID
    MGI:3623355
Genes
Gtf2a1l general transcription factor IIA, 1-like
Expression
  • Assay Results
    45
References
J:105948 Xiao L, et al., Developmental and cell type-specific regulation of core promoter transcription factors in germ cells of frogs and mice. Gene Expr Patterns. 2006 Apr;6(4):409-19

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
08/03/2022
MGI 6.21
The Jackson Laboratory