About   Help   FAQ
mDESC1F, mDESC1R Primer Detail
Primers
  • Name
    mDESC1F, mDESC1R
  • Primer 1 Sequence
    TGGATTGCTTCCAACACTGGTAT
  • Primer 2 Sequence
    CCATTTGTGTGTCTCCAAGAACC
  • ID
    MGI:3622135
Genes
Tmprss11e transmembrane protease, serine 11e
Expression
  • Assay Results
    4
References
J:105558 Kim TS, et al., Phenotypic analysis of mice lacking the Tmprss2-encoded protease. Mol Cell Biol. 2006 Feb;26(3):965-75

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
10/08/2019
MGI 6.14
The Jackson Laboratory