About   Help   FAQ
GITR-pA, GITR-pB Primer Detail
Primers
  • Name
    GITR-pA, GITR-pB
  • Primer 1 Sequence
    GACGGTCACTGCAGACTTTG
  • Primer 2 Sequence
    GCCATGACCAGGAAGATGAC
  • ID
    MGI:3615440
Genes
Tnfrsf18 tumor necrosis factor receptor superfamily, member 18
Expression
  • Assay Results
    10
References
J:102895 Wang J, et al., Glucocorticoid-induced tumor necrosis factor receptor is a p21Cip1/WAF1 transcriptional target conferring resistance of keratinocytes to UV light-induced apoptosis. J Biol Chem. 2005 Nov 11;280(45):37725-31

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
11/26/2019
MGI 6.14
The Jackson Laboratory