About   Help   FAQ
2700088M22Rik-pA, 2700088M22Rik-pB Primer Detail
Primers
  • Name
    2700088M22Rik-pA, 2700088M22Rik-pB
  • Primer 1 Sequence
    GGCTTGGCGCCAAGTAAAAGC
  • Primer 2 Sequence
    CACTAAGTTCTTCTTCATCAC
  • ID
    MGI:3614659
Genes
Zcrb1 zinc finger CCHC-type and RNA binding motif 1
Expression
  • Assay Results
    2
References
J:103446 McKee AE, et al., A genome-wide in situ hybridization map of RNA-binding proteins reveals anatomically restricted expression in the developing mouse brain. BMC Dev Biol. 2005 Jul 20;5:14

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
03/03/2020
MGI 6.15
The Jackson Laboratory