About   Help   FAQ
D1Dcr5-pA, pB Primer Detail
Primers
  • Name
    D1Dcr5-pA, pB
  • Primer 1 Sequence
    CCTTGGACACATTCACAGACACA
  • Primer 2 Sequence
    GGGCCCAGTACTTTTTATTTCTCTCT
  • ID
    MGI:3611319
  • Product Size
    128 bp
  • Other IDs
    478941 (NCBI UniSTS)
  • Synonyms
    D1Dcr5-pA1, pB1
Genes
D1Dcr5 DNA segment, Chr 1, Derry C. Roopenian 5
Polymorphisms
J:104145 Bubier J, MGI Direct Data Submission. 2006;
Endonuclease Gene Allele Fragments Strains
D1Dcr5 a not given 129X1/SvJ
b 127 bp C57BL/6J
References
J:104145 Bubier J, Mapping and polymorphisms for mouse Chromosome 1, 5 sequence tag sites. MGI Direct Data Submission. 2006;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;
J:127014 Sproule TJ, et al., Mapping of primers in the mouse. MGI Direct Data Submission. 2007;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
07/29/2020
MGI 6.15
The Jackson Laboratory