About   Help   FAQ
mFen1-pA, mFen1-pB Primer Detail
Primers
  • Name
    mFen1-pA, mFen1-pB
  • Primer 1 Sequence
    GGTGGAGGAGAGGTGACTAG
  • Primer 2 Sequence
    GCACAACTACTGGACTCAGC
  • ID
    MGI:3604532
Genes
Fen1 flap structure specific endonuclease 1
Expression
  • Assay Results
    12
References
J:101008 Emoto M, et al., Structure and transcription promoter activity of mouse flap endonuclease 1 gene: alternative splicing and bidirectional promoter. Gene. 2005 Aug 29;357(1):47-54

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
03/03/2020
MGI 6.15
The Jackson Laboratory