About   Help   FAQ
Enpp2-pA, Enpp2-pB Primer Detail
Primers
  • Name
    Enpp2-pA, Enpp2-pB
  • Primer 1 Sequence
    TGCTCAGAAGACTGCTTGTCC
  • Primer 2 Sequence
    CAGGCTGCTCGGAGTAGAAGG
  • ID
    MGI:3588070
Genes
Enpp2 ectonucleotide pyrophosphatase/phosphodiesterase 2
Expression
  • Assay Results
    5
References
J:96550 Williams TM, et al., Candidate downstream regulated genes of HOX group 13 transcription factors with and without monomeric DNA binding capability. Dev Biol. 2005 Mar 15;279(2):462-80

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
08/03/2022
MGI 6.21
The Jackson Laboratory