About   Help   FAQ
Foxi3-pA, Foxi3-pB Primer Detail
Primers
  • Name
    Foxi3-pA, Foxi3-pB
  • Primer 1 Sequence
    GGAAGGGTAATTACTGGACTC
  • Primer 2 Sequence
    ATGAGGCTGTTGACCATGCTG
  • ID
    MGI:3580794
Genes
Foxi3 forkhead box I3
References
J:93815 Ohyama T, et al., Expression of mouse Foxi class genes in early craniofacial development. Dev Dyn. 2004 Nov;231(3):640-6

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
04/13/2021
MGI 6.16
The Jackson Laboratory