About   Help   FAQ
LST-1, RTANK-3 Primer Detail
Primers
  • Name
    LST-1, RTANK-3
  • Primer 1 Sequence
    GGTAGTTTTCTGTCAGTGG
  • Primer 2 Sequence
    GAAGACTGTGCATTGACATC
  • ID
    MGI:3531458
Genes
Ankrd17 ankyrin repeat domain 17
Expression
  • Assay Results
    13
References
J:67263 Watt AJ, et al., A gene trap integration provides an early in situ marker for hepatic specification of the foregut endoderm. Mech Dev. 2001 Feb;100(2):205-15

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
11/16/2021
MGI 6.17
The Jackson Laboratory