About   Help   FAQ
Sf1-pA, Sf1-pB Primer Detail
Primers
  • Name
    Sf1-pA, Sf1-pB
  • Primer 1 Sequence
    CGCAACAACCTTCTCATTGAGA
  • Primer 2 Sequence
    TGGATCCCTAATGCAAGGAGTCT
  • ID
    MGI:3510940
Genes
Nr5a1 nuclear receptor subfamily 5, group A, member 1
Expression
  • Assay Results
    44
References
J:93500 Bouma GJ, et al., Using real time RT-PCR analysis to determine multiple gene expression patterns during XX and XY mouse fetal gonad development. Gene Expr Patterns. 2004 Nov;5(1):141-9

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
03/24/2020
MGI 6.15
The Jackson Laboratory