About   Help   FAQ
50.MUSACHRA Primer Detail
Primers
  • Name
    50.MUSACHRA
  • Primer 1 Sequence
    ACCGTTCACAGCTGACCTAGT
  • Primer 2 Sequence
    GGGACACAGATGTACTAAGCT
  • ID
    MGI:329
  • Product Size
    112bp
Genes
Chrng cholinergic receptor, nicotinic, gamma polypeptide
Polymorphisms
J:10652 Love JM, et al., Nucleic Acids Res. 1990 Jul 25;18(14):4123-30
Endonuclease Gene Allele Fragments Strains
Chrng b larger C57BL/6J
n smaller B10.H2nod, DBA/2J, NOD, NON
s smallest M. spretus
References
J:10652 Love JM, et al., Towards construction of a high resolution map of the mouse genome using PCR-analysed microsatellites. Nucleic Acids Res. 1990 Jul 25;18(14):4123-30

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
03/24/2020
MGI 6.15
The Jackson Laboratory