About   Help   FAQ
Glut12-pA, Glut12-pB Primer Detail
Primers
  • Name
    Glut12-pA, Glut12-pB
  • Primer 1 Sequence
    GCCAGCTTGCTTGTTTATGT
  • Primer 2 Sequence
    GCTGTGTTGGCACTAATTCTTCCTGG
  • ID
    MGI:3057006
  • Region Covered
    3' untranslated region
  • Product Size
    383bp
Genes
Slc2a12 solute carrier family 2 (facilitated glucose transporter), member 12
Expression
  • Assay Results
    21
References
J:93151 Zhou Y, et al., Identification of the facilitative glucose transporter 12 gene Glut12 in mouse preimplantation embryos. Gene Expr Patterns. 2004 Oct;4(6):621-31

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
11/30/2021
MGI 6.17
The Jackson Laboratory