About   Help   FAQ
6OST3-FP1, 6OST3-RP1 Primer Detail
Primers
  • Name
    6OST3-FP1, 6OST3-RP1
  • Primer 1 Sequence
    TGAATGAGAGCGAGCGGAAC
  • Primer 2 Sequence
    TGGATTGGAAATGAAGGCAGAG
  • ID
    MGI:3055740
Genes
Hs6st3 heparan sulfate 6-O-sulfotransferase 3
Expression
  • Assay Results
    6
References
J:81601 Ford-Perriss M, et al., Variant heparan sulfates synthesized in developing mouse brain differentially regulate FGF signaling. Glycobiology. 2002 Nov;12(11):721-7

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
11/23/2021
MGI 6.17
The Jackson Laboratory