About   Help   FAQ
B3galt4-pA, B3galt4-pB Primer Detail
Primers
  • Name
    B3galt4-pA, B3galt4-pB
  • Primer 1 Sequence
    ATATCCCTGTGTGCTGCTGA
  • Primer 2 Sequence
    CTGTTTGGACCTTCAGGCTT
  • ID
    MGI:3055008
Genes
B3galt4 UDP-Gal:betaGlcNAc beta 1,3-galactosyltransferase, polypeptide 4
Expression
  • Assay Results
    9
References
J:89731 Abe K, et al., Gene content of the 750-kb critical region for mouse embryonic ectoderm lethal tcl-w5. Mamm Genome. 2004 Apr;15(4):265-76

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
11/30/2021
MGI 6.17
The Jackson Laboratory