About   Help   FAQ
Pou5f1-pG, Pou5f1-pH Primer Detail
Primers
  • Name
    Pou5f1-pG, Pou5f1-pH
  • Primer 1 Sequence
    CCCCCACTTCACCACACTC
  • Primer 2 Sequence
    GCATCACTGAGCTTCTTTCCC
  • ID
    MGI:3033238
Genes
Pou5f1 POU domain, class 5, transcription factor 1
References
J:88265 Hurley TM, et al., Eki2 is upregulated specifically in the testis during mouse sex determination. Gene Expr Patterns. 2004 Apr;4(2):135-40

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
06/23/2020
MGI 6.15
The Jackson Laboratory