About   Help   FAQ
EphA2-pA, EphA2-pB Primer Detail
Primers
  • Name
    EphA2-pA, EphA2-pB
  • Primer 1 Sequence
    TCAAGACGCTGGCTGACTTTG
  • Primer 2 Sequence
    GGCCCCAATGGACTCAGATAG
  • ID
    MGI:3029507
  • Product Size
    303bp
Genes
Epha2 Eph receptor A2
Expression
  • Assay Results
    4
References
J:83513 Pickles JO, Expression of Ephs and ephrins in developing mouse inner ear. Hear Res. 2003 Apr;178(1-2):44-51

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
02/11/2020
MGI 6.14
The Jackson Laboratory