About   Help   FAQ
ARVCF-pA, ARVCF-pB Primer Detail
Primers
  • Name
    ARVCF-pA, ARVCF-pB
  • Primer 1 Sequence
    GAGGGCCCGCCATCTTGAGC
  • Primer 2 Sequence
    CAGGCCCCGAGGTTACTTGAGG
  • ID
    MGI:3028098
  • Product Size
    538bp
Genes
Arvcf armadillo repeat gene deleted in velocardiofacial syndrome
Expression
  • Assay Results
    32
References
J:86704 Maynard TM, et al., A comprehensive analysis of 22q11 gene expression in the developing and adult brain. Proc Natl Acad Sci U S A. 2003 Nov 25;100(24):14433-8

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
11/30/2021
MGI 6.17
The Jackson Laboratory