About   Help   FAQ
D1Pgn7-pA, D1Pgn7-pB Primer Detail
Primers
  • Name
    D1Pgn7-pA, D1Pgn7-pB
  • Primer 1 Sequence
    CAGTGTCCAAAGTGCTGATG
  • Primer 2 Sequence
    TCTCTATGCCATTTGGAAGG
  • ID
    MGI:3027015
  • Other IDs
    265656 (NCBI UniSTS)
Genes
D1Pgn7 DNA segment, Chr 1, Paigen 7
References
J:87496 Kelmenson PM, et al., A torrid zone on mouse Chromosome 1 containing a cluster of recombinational hotspots. MGI Direct Data Submission. 2004;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
06/30/2020
MGI 6.15
The Jackson Laboratory