About   Help   FAQ
ST6GalNacII-pA, ST6GalNacII-pB Primer Detail
Primers
  • Name
    ST6GalNacII-pA, ST6GalNacII-pB
  • Primer 1 Sequence
    AGACCCAGGTTCCCGCCAGG
  • Primer 2 Sequence
    AAGGAGGTCTTAGTGCCCAC
  • ID
    MGI:2678588
  • Product Size
    481bp
Genes
St6galnac2 ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 2
Expression
  • Assay Results
    13
Sequences
References
J:55849 Takashima S, et al., Quantitative analysis of expression of mouse sialyltransferase genes by competitive PCR. Biochem Biophys Res Commun. 1999 Jun 24;260(1):23-7

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
11/16/2021
MGI 6.17
The Jackson Laboratory