About   Help   FAQ
0610016J10Rik-pC,0610016J10Rik-pD Primer Detail
Primers
  • Name
    0610016J10Rik-pC,0610016J10Rik-pD
  • Primer 1 Sequence
    CCCATGCGGGATACACATAC
  • Primer 2 Sequence
    GCTTTCCATGGCTTTAGCTG
  • ID
    MGI:2674382
Genes
Memo1 mediator of cell motility 1
Expression
  • Assay Results
    2
References
J:80501 Gitton Y, et al., A gene expression map of human chromosome 21 orthologues in the mouse. Nature. 2002 Dec 5;420(6915):586-90

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
09/22/2022
MGI 6.21
The Jackson Laboratory