About   Help   FAQ
Krtap12-1-pA,Krtap12-1-pB Primer Detail
Primers
  • Name
    Krtap12-1-pA,Krtap12-1-pB
  • Primer 1 Sequence
    GGCCTGCTATATGCATTCCT
  • Primer 2 Sequence
    ACAGGCTTGCAGACCAGAGT
  • ID
    MGI:2665997
Genes
Krtap12-1 keratin associated protein 12-1
Expression
  • Assay Results
    16
References
J:80502 Reymond A, et al., Human chromosome 21 gene expression atlas in the mouse. Nature. 2002 Dec 5;420(6915):582-6

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
11/26/2019
MGI 6.14
The Jackson Laboratory