About   Help   FAQ
F1, R1 Primer Detail
Primers
  • Name
    F1, R1
  • Primer 1 Sequence
    TTCCCAGTCCCAAATCAGTG
  • Primer 2 Sequence
    GAGTCCTGGTGTGTCCTTTG
  • ID
    MGI:2665833
Genes
Cd248 CD248 antigen, endosialin
Expression
  • Assay Results
    24
References
J:72180 Opavsky R, et al., Molecular characterization of the mouse Tem1/endosialin gene regulated by cell density in vitro and expressed in normal tissues in vivo. J Biol Chem. 2001 Oct 19;276(42):38795-807

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
01/14/2020
MGI 6.14
The Jackson Laboratory