About   Help   FAQ
Myo18b-pA, Myo18b-pB Primer Detail
Primers
  • Name
    Myo18b-pA, Myo18b-pB
  • Primer 1 Sequence
    TGCAAAGTGGGCCGGAAGCA
  • Primer 2 Sequence
    TGATGAGGGAGACCACAGCCACGA
  • ID
    MGI:2664312
  • Region Covered
    5' region (nucleotides 991-1258)
  • Product Size
    268bp
Genes
Myo18b myosin XVIIIb
Expression
  • Assay Results
    11
Sequences
AK016515 (GenBank | EMBL | ENA | DDBJ | MGI Sequence Detail)
References
J:83690 Salamon M, et al., Human MYO18B, a novel unconventional myosin heavy chain expressed in striated muscles moves into the myonuclei upon differentiation. J Mol Biol. 2003 Feb 7;326(1):137-49

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
11/16/2021
MGI 6.17
The Jackson Laboratory