About   Help   FAQ
mPJA2, mPJA3 Primer Detail
Primers
  • Name
    mPJA2, mPJA3
  • Primer 1 Sequence
    GGTCGCTGTGAAGACCATGA
  • Primer 2 Sequence
    CTCAGGTACTCCATACCACT
  • ID
    MGI:2660618
  • Region Covered
    nucleotides 1675-1977
  • Product Size
    303bp
Genes
Axl AXL receptor tyrosine kinase
Expression
  • Assay Results
    14
Sequences
References
J:26233 Graham DK, et al., Cloning and developmental expression analysis of the murine c-mer tyrosine kinase. Oncogene. 1995 Jun 15;10(12):2349-59

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
11/23/2021
MGI 6.17
The Jackson Laboratory