About   Help   FAQ
c-fos-pC, c-fos-pD Primer Detail
Primers
  • Name
    c-fos-pC, c-fos-pD
  • Primer 1 Sequence
    GACTTTTGCGCAGATCTGTC
  • Primer 2 Sequence
    TCTACTTTGCCCCTTCTGCC
  • ID
    MGI:2656884
  • Product Size
    0.250kb
Genes
Fos FBJ osteosarcoma oncogene
Expression
  • Assay Results
    7
References
J:34958 Coucouvanis EC, et al., Changes in protooncogene expression correlated with general and sex-specific differentiation in murine primordial germ cells. Mech Dev. 1993 Jul;42(1-2):49-58

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
05/26/2020
MGI 6.15
The Jackson Laboratory