About   Help   FAQ
Ranbp2-pA, Ranbp2-pB Primer Detail
Primers
  • Name
    Ranbp2-pA, Ranbp2-pB
  • Primer 1 Sequence
    CAGACCAGCTGCTAATGTAACTCCCA
  • Primer 2 Sequence
    TGGGCCCATGTTTTCTGTAAGTGTATT
  • ID
    MGI:2656857
  • Product Size
    0.67kb
Genes
Ranbp2 RAN binding protein 2
Expression
  • Assay Results
    15
References
J:69825 Fauser S, et al., Genomic organization, expression, and localization of murine Ran-binding protein 2 (RanBP2) gene. Mamm Genome. 2001 Jun;12(6):406-15

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
02/18/2020
MGI 6.14
The Jackson Laboratory