About   Help   FAQ
Primer A, Primer B Primer Detail
Primers
  • Name
    Primer A, Primer B
  • Primer 1 Sequence
    TGGGAATCATTAACAAGAGTCCCTGAC
  • Primer 2 Sequence
    AGTCAGGAATCGGCCTCTAGG
  • ID
    MGI:2654590
Genes
Hpn hepsin
Expression
  • Assay Results
    2
References
J:44629 Vu TKH, et al., Identification and cloning of the membrane-associated serine protease, hepsin, from mouse preimplantation embryos. J Biol Chem. 1997 Dec 12;272(50):31315-20

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
11/23/2021
MGI 6.17
The Jackson Laboratory