About   Help   FAQ
GpIX-pA, GpIX-pB Primer Detail
Primers
  • Name
    GpIX-pA, GpIX-pB
  • Primer 1 Sequence
    AACAATAGCCTGCGTTCAGTGCC
  • Primer 2 Sequence
    ATAGACCAGCCAGCAGAATCAGG
  • ID
    MGI:2652157
Genes
Gp9 glycoprotein 9 (platelet)
Expression
  • Assay Results
    6
References
J:64178 Hart A, et al., Fli-1 is required for murine vascular and megakaryocytic development and is hemizygously deleted in patients with thrombocytopenia. Immunity. 2000 Aug;13(2):167-77

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
04/13/2021
MGI 6.16
The Jackson Laboratory