About   Help   FAQ
Tnfr1-pA, Tnfr1-pB Primer Detail
Primers
  • Name
    Tnfr1-pA, Tnfr1-pB
  • Primer 1 Sequence
    GAGCCACCAGAGACCAAGAA
  • Primer 2 Sequence
    GCCTTAGAGGTAGCAACAAA
  • ID
    MGI:240
Genes
Tnfrsf1a tumor necrosis factor receptor superfamily, member 1a
Polymorphisms
J:12633 Takao S, et al., Immunogenetics. 1993;37(3):199-203
Notes: Unique sequence flanking the microsatellite were synthesized to use in PCR amplification.
Endonuclease Gene Allele Fragments Strains
Tnfrsf1a a 171bp AKR, BALB/c, C3H, DBA/1, DBA/2, MRL, NOD, NON, NZW, P/J, SJL/J
b 193bp BXSB, C57BL/6, CBA, NZB, PL/J, SM/J
c 197bp M. m. musculus, SWR
m 173bp M. m. domesticus poschiavinus
s 149.0bp M. spretus
References
J:12633 Takao S, et al., Novel DNA polymorphism in the mouse tumor necrosis factor receptors type 1 and type 2. Immunogenetics. 1993;37(3):199-203

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
04/06/2021
MGI 6.16
The Jackson Laboratory