About   Help   FAQ
D8Srb2-pA, -pB Primer Detail
Primers
  • Name
    D8Srb2-pA, -pB
  • Primer 1 Sequence
    GGCAAAGTTACATGACTGAGTGAAC
  • Primer 2 Sequence
    ACAAGGCCTTGAAGGAATAGCTTC
  • ID
    MGI:2180074
  • Other IDs
    239024 (NCBI UniSTS)
Genes
D8Srb2 DNA sement, Chr 8, Sotiria R. Boukouvala 2
Polymorphisms
J:69675 Boukouvala S, et al., Pharmacogenetics. 2002 Jul;12(5):385-94
Endonuclease Gene Allele Fragments Strains
D8Srb2 a 153 bp 129P/Ola, A/J, BALB/c, C57BL/6J, PO, TO
b 151 bp CBA
c 145 bp M. spretus
d 161 bp M. m. castaneus
References
J:69675 Boukouvala S, et al., Identification and functional characterization of novel polymorphisms associated with the genes for arylamine N-acetyltransferases in mice. Pharmacogenetics. 2002 Jul;12(5):385-94
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
02/16/2021
MGI 6.16
The Jackson Laboratory