About   Help   FAQ
Crya1-F, Crya1-R Primer Detail
Primers
  • Name
    Crya1-F, Crya1-R
  • Primer 1 Sequence
    GATGGCCTGCTAATCTGTGC
  • Primer 2 Sequence
    GAACCAAGGATGCTGAATGG
  • ID
    MGI:2153446
  • Region Covered
    unspecified
Genes
Cryaa crystallin, alpha A
References
J:69673 Davisson MT, et al., Evolutionary breakpoints on human chromosome 21. Genomics. 2001 Nov;78(1/2):99-106

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
01/19/2021
MGI 6.16
The Jackson Laboratory