About   Help   FAQ
Mypt3-pA, Mypt3-pB Primer Detail
Primers
  • Name
    Mypt3-pA, Mypt3-pB
  • Primer 1 Sequence
    GACTGAGAGCTGCTGCATGAAGG
  • Primer 2 Sequence
    CAAGTGTCTGAGCTCTCACCAGAG
  • ID
    MGI:2135930
  • Region Covered
    intron 1 to intron 3
  • Product Size
    0.4 kb
Genes
Ppp1r16a protein phosphatase 1, regulatory subunit 16A
References
J:69661 Skinner JA, et al., Cloning and identification of MYPT3: a prenylatable myosin targetting subunit of protein phosphatase 1. Biochem J. 2001 May 15;356(Pt 1):257-67

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
05/26/2020
MGI 6.15
The Jackson Laboratory