About   Help   FAQ
Il1b-pA, Il1b-pB Primer Detail
Primers
  • Name
    Il1b-pA, Il1b-pB
  • Primer 1 Sequence
    AACGTGTGGGGGATGAATTG
  • Primer 2 Sequence
    CATACTCATCAAAGCAATGT
  • ID
    MGI:213
Genes
Il1b interleukin 1 beta
Polymorphisms
J:4404 Takahashi N, et al., Genomics. 1993 Apr;16(1):161-8
Notes: Genomic DNA was amplified via PCR and organized into allele groupings based on sequence similarity.
Endonuclease Gene Allele Fragments Strains
Il1b b not given C57BL/6J, CAST/EiJ, DBA/2J
m not given MOLF/EiJ
s not given M. spretus
References
J:4404 Takahashi N, et al., The short 3'-end region of complementary DNAs as PCR-based polymorphic markers for an expression map of the mouse genome. Genomics. 1993 Apr;16(1):161-8

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
12/03/2019
MGI 6.14
The Jackson Laboratory