About   Help   FAQ
Cripto-pA, Cripto-pB Primer Detail
Primers
  • Name
    Cripto-pA, Cripto-pB
  • Primer 1 Sequence
    AGCATCCTACGAGGGAGTTGA
  • Primer 2 Sequence
    ATTGTATATAGCTTGGAGAAA
  • ID
    MGI:1934661
  • Region Covered
    Primer 1 corresponds to nt 1149-1169; Primer 2 is complementary to nt 1482-1462; both are within the 3' untranslated region
Genes
Tdgf1 teratocarcinoma-derived growth factor 1
Expression
  • Assay Results
    5
References
J:14355 Dono R, et al., The murine cripto gene: expression during mesoderm induction and early heart morphogenesis. Development. 1993 Aug;118(4):1157-68

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
02/23/2021
MGI 6.16
The Jackson Laboratory