About   Help   FAQ
Gjb4-pA, Gjb4-pB Primer Detail
Primers
  • Name
    Gjb4-pA, Gjb4-pB
  • Primer 1 Sequence
    GCCACGGTGGATGCAGGTGTGTA
  • Primer 2 Sequence
    TGCAGGTCATGGATACACACCTGC
  • ID
    MGI:1934169
Genes
Gjb4 gap junction protein, beta 4
References
J:68340 Maeda YY, et al., Two interactive genes responsible for a new inherited cataract (RCT) in the mouse. Mamm Genome. 2001 Apr;12(4):278-83

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
12/03/2019
MGI 6.14
The Jackson Laboratory