About   Help   FAQ
mNDST2-1F, mNDST2-1R Primer Detail
Primers
  • Name
    mNDST2-1F, mNDST2-1R
  • Primer 1 Sequence
    TGCAACATTCCAGTGTGGGCTGATGGC
  • Primer 2 Sequence
    ATGACATTAGAGAGGCCAGGCCACAGG
  • ID
    MGI:1932966
Genes
Ndst2 N-deacetylase/N-sulfotransferase (heparan glucosaminyl) 2
Expression
  • Assay Results
    30
References
J:67535 Aikawa J, et al., Multiple isozymes of heparan sulfate/heparin GlcNAc N-deacetylase/GlcN N-sulfotransferase. Structure and activity of the fourth member, NDST4. J Biol Chem. 2001 Feb 23;276(8):5876-82
J:81601 Ford-Perriss M, et al., Variant heparan sulfates synthesized in developing mouse brain differentially regulate FGF signaling. Glycobiology. 2002 Nov;12(11):721-7

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
12/03/2019
MGI 6.14
The Jackson Laboratory