About   Help   FAQ
Aqp7-pC, Aqp7-pD Primer Detail
Primers
  • Name
    Aqp7-pC, Aqp7-pD
  • Primer 1 Sequence
    AACTGTGCACTAGGCCGAATG
  • Primer 2 Sequence
    GTGATGGCGAAGATACACAGC
  • ID
    MGI:1930158
Genes
Aqp7 aquaporin 7
Expression
  • Assay Results
    7
References
J:65472 Offenberg H, et al., mRNAs encoding aquaporins are present during murine preimplantation development. Mol Reprod Dev. 2000 Dec;57(4):323-30

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
05/26/2020
MGI 6.15
The Jackson Laboratory