About   Help   FAQ
331T-pA, 331T-pB Primer Detail
Primers
  • Name
    331T-pA, 331T-pB
  • Primer 1 Sequence
    CTCCCTTCCTTCCTGATCGTTTTC
  • Primer 2 Sequence
    CGGCTCTCAAGCACTGCAGATTTTG
  • ID
    MGI:1858923
  • Region Covered
    located 3' downstream of Punc
  • Product Size
    0.111kb
Genes
331T DNA segment, 331T
References
J:61062 Salbaum JM, et al., Cloning and expression of nope, a new mouse gene of the immunoglobulin superfamily related to guidance receptors. Genomics. 2000 Feb 15;64(1):15-23

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
03/31/2020
MGI 6.15
The Jackson Laboratory