About   Help   FAQ
Myf5-p1, Myf5-p3 Primer Detail
Primers
  • Name
    Myf5-p1, Myf5-p3
  • Primer 1 Sequence
    GAGCTGCTGAGGGAACAGGTGGAGA
  • Primer 2 Sequence
    CCTAGCAGGAGTGATCATCGGGAGAGAGT
  • ID
    MGI:1351278
Genes
Myf5 myogenic factor 5
Expression
  • Assay Results
    2
References
J:56581 Daubas P, et al., Myf5 is a novel early axonal marker in the mouse brain and is subjected to post-transcriptional regulation in neurons. Development. 2000 Jan;127(2):319-31

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
01/14/2020
MGI 6.14
The Jackson Laboratory