About   Help   FAQ
Ron-pA, Ron-pB Primer Detail
Primers
  • Name
    Ron-pA, Ron-pB
  • Primer 1 Sequence
    GGTGGGTTTAACGGTTAGGG
  • Primer 2 Sequence
    TCTGGGCTCTGCCTCCTTAT
  • ID
    MGI:1349623
  • Region Covered
    part of the Ron cDNA
Genes
Mst1r macrophage stimulating 1 receptor (c-met-related tyrosine kinase)
Polymorphisms
J:57881 Persons DA, et al., Nat Genet. 1999 Oct;23(2):159-65
Endonuclease Gene Allele Fragments Strains
Mst1r a not given 129X1/SvJ
b not given C57BL/6
References
J:57881 Persons DA, et al., Fv2 encodes a truncated form of the Stk receptor tyrosine kinase [see comments]. Nat Genet. 1999 Oct;23(2):159-65

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
02/16/2021
MGI 6.16
The Jackson Laboratory