About   Help   FAQ
Cd52-pA, Cd52-pB Primer Detail
Primers
  • Name
    Cd52-pA, Cd52-pB
  • Primer 1 Sequence
    CGGGTTCGATTACCATCACC
  • Primer 2 Sequence
    TCCAGGAACCGGTAGCAAG
  • ID
    MGI:1346589
Genes
Cd52 CD52 antigen
Polymorphisms
J:57458 Tone M, et al., Biochim Biophys Acta. 1999 Sep 3;1446(3):334-40
Endonuclease Gene Allele Fragments Strains
Cd52 b not given C57BL/6
s not given M. spretus
References
J:57458 Tone M, et al., Structure and chromosomal location of mouse and human CD52 genes. Biochim Biophys Acta. 1999 Sep 3;1446(3):334-40

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
01/21/2020
MGI 6.14
The Jackson Laboratory