About   Help   FAQ
Y11(II)-F, Y11(II)-R Primer Detail
Primers
  • Name
    Y11(II)-F, Y11(II)-R
  • Primer 1 Sequence
    CTGAGCTTGTCTTCATCAGGA
  • Primer 2 Sequence
    TCAGCAACGATTCCATTCCCA
  • ID
    MGI:1345728
Genes
Y11(II) DNA segment, Y11(II)
Polymorphisms
J:56599 Shinbo T, et al., Oncogene. 1999 Jul 15;18(28):4131-6
Endonuclease Gene Allele Fragments Strains
Y11(II) b not given BALB/c
m not given MSM/Ms
References
J:56599 Shinbo T, et al., Allelic loss mapping and physical delineation of a region harboring a putative thymic lymphoma suppressor gene on mouse chromosome 12. Oncogene. 1999 Jul 15;18(28):4131-6

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
02/16/2021
MGI 6.16
The Jackson Laboratory