About   Help   FAQ
Mbd1-pA, Mbd1-pB Primer Detail
Primers
  • Name
    Mbd1-pA, Mbd1-pB
  • Primer 1 Sequence
    TGAGGAGTACACAGTGACTG
  • Primer 2 Sequence
    GCATCGGTACCAACATTGT
  • ID
    MGI:1343324
  • Region Covered
    part of intronic sequence
Genes
Mbd1 methyl-CpG binding domain protein 1
Polymorphisms
J:56861 Hendrich B, et al., Mamm Genome. 1999 Sep;10(9):906-12
Endonuclease Gene Allele Fragments Strains
MspI Mbd1 b not given C57BL/6JEiJ
s not given SPRET/EiJ
References
J:56861 Hendrich B, et al., Genomic structure and chromosomal mapping of the murine and human Mbd1, Mbd2, Mbd3, and Mbd4 genes. Mamm Genome. 1999 Sep;10(9):906-12

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
05/17/2022
MGI 6.19
The Jackson Laboratory